Hif1a gene length
Web25 de ago. de 2024 · We aimed to evaluate the effect of selected polymorphisms of the ACTN3, ACE, HIF1A and PPARA genes on the immediate supercompensation training effect of elite Slovak endurance runners and football players compared with a sedentary control group. Adaptation effect levels were evaluated by 10 s continuous vertical jump … WebHypoxia-inducible factor-1α (encoded by HIF1A gene) controls a number of genes that are implicated in various cellular functions including glycolysis and cell proliferation and …
Hif1a gene length
Did you know?
Web22 de dez. de 2024 · The top panel shows the length of the HIF1A gene (chromosome 14 at position 61.695.512–61.748.259). Three isoforms of the gene are known, which contain 14–15 exons (indicated by the grey boxes). The green, red, and yellow, boxes visualize the three target consecutive exons (exon two, −three, and −four). Web13 de mar. de 2024 · CircHIF1A is located at chr14:62187099-62194373 and is 738 bp in length, with high conservation in ... circBaseID: hsa_circ_0004623) derived from exons 2–6 of the HIF1A gene, which is located at ...
Web28 de set. de 2024 · Integrative HIF1A gene map was visualized and includes transcriptional and post-transcriptional regulators, ... the translation length is 826 residues, and it is associated with 14,136 variant alleles WebThe gene view histogram is a graphical view of mutations across HIF1A. These mutations are displayed at the amino acid level across the full length of the gene by default. Restrict the view to a region of the gene by dragging across the histogram to highlight the region of interest, or by using the sliders in the filters panel to the left.
WebSummary of HIF1A expression in human tissue. Mainly nuclear expression but cytoplasmic as well in some tissues. ... Gene ontology. Length (aa) Molecular mass (kDa) Signal peptide (predicted) Transmembrane regions (predicted) HIF1A-001: ENSP00000338018 ENST00000337138: Q16665 WebNM_001530.4(HIF1A):c.2075C>G (p.Ser692Cys) Cite this record. Cite this record Close. Copy. Help Interpretation: Likely pathogenic Review status: criteria provided, single submitter Submissions: 1 First in ClinVar ...
WebHIF-1α is a transcriptional factor encoded by the HIF1A gene located within chromosome 14q21-24 and is formed by 15 exons; HIF-1α consists of 826 amino acids and it has a molecular weight of 120 kDa. 48 48 Loboda A, Jozkowicz A, Dulak J. HIF-1 and HIF-2 transcription factors–similar but not identical.
Web21 de mar. de 2024 · GeneCards Summary for HIF1A Gene. HIF1A (Hypoxia Inducible Factor 1 Subunit Alpha) is a Protein Coding gene. Diseases associated with HIF1A include Retinal Ischemia and Enchondromatosis, Multiple, Ollier Type . Among its related … Complete information for TRMT5 gene (Protein Coding), TRNA … Complete information for HIF1A-AS3 gene (RNA Gene), HIF1A Antisense RNA 3, … Complete information for HIF1A-AS1 gene (RNA Gene), HIF1A Antisense RNA 1, … Complete information for SRMP2 gene (Pseudogene), SRM Pseudogene 2, … devextreme time pickerWeb17 de ago. de 2024 · The following sets of primers were used for PCR amplification of DNA products that are specific to Cre- recombined alleles of the Hif1a 86 and Hif2a 87 genes. Hif1a (Fwd II GCAGTTAAGAGCACTAGTTG ... devextreme widthWeb13 de jan. de 2016 · However, compared with control WT mice, the retinal vessels of Hif1a KA/KA mice displayed increased radial length (1.2-fold) and vascular density (1.3-fold; Fig. 5a–c). devextreme grid column chooserWebInteraction with PSMA7 inhibits the transactivation activity of HIF1A under both normoxic and hypoxia-mimicking conditions (PubMed:11389899). Interacts with USP20 … churches obion county tnWeb6 de abr. de 2024 · Interestingly, the overexpression of truncated HIF-1α induced the accumulation of full-length HIF-1α protein (Figure 5a) independently on transcription of … devey and sonsWeb99 hif1a Affordable TaqMan Assays for All of Your qPCR Needs Sign in. Don't ... Amplicon Length Between 400-700 bp (28) Between 200-400 bp ... Gene. HIF1A HIF1AA... Species Human Location. Chr.14: 61695276-61695762 on GRCh38; Amp. Len. 487 devey close knebworthWeb26 de fev. de 2024 · Full length or the RRM deletion mutant (D RRM) of hnRNPF was transfected into HEK293 cells for HIFAL RNA-pull down assay. l , m HnRNPF 141–178aa region contains the HIFAL binding domain. churches oamaru